Información de la revista
Vol. 89. Núm. 10.
Páginas 519-529 (Octubre 1998)
Compartir
Compartir
Más opciones de artículo
Vol. 89. Núm. 10.
Páginas 519-529 (Octubre 1998)
Acceso a texto completo
Estudio clínico y genético de tres familias afectadas por la enfermedad de Darier
A clinical and genetic study of three DarierÕs disease affected families.
Visitas
...
Juan Redondo Mateo, Eladio Velasco Sampedro, Susana Gómez Barrero, Fernanda Rodríguez-Sanz, Luis Erick Clavería Soria
Información del artículo
Resumen
Texto completo
Estadísticas
La enfermedad de Darier es un trastorno cutáneo cuya expresividad clínica es variable y diversa, y está caracterizada por la presencia de pápulas queratósicas, lesiones en mucosas, fundamentalmente en boca, alteraciones ungueales y queratodermia palmoplantar, pudiendo afectarse otros órganos de la economía. Se hereda de una forma autosómica dominante y su prevalencia es aproximadamente de 1/50.000. El gen causante de la enfermedad de Darier fue localizado en el brazo largo del cromosoma 12, bandas q23-q24.1. Desde un punto de vista clínico, hemos estudiado tres familias de nuestro entorno, encontrando que las alteraciones ungueales y la queratodermia palmoplantar son las más frecuentes. La afectación cutaneo-mucosa variaba ampliamente en intensidad y extensión, de unos pacientes a otros, tanto ínter como intrafamiliarmente. Por otro lado, hemos efectuado un análisis de ligamiento genético con nueve microsatélites del cromosoma 12q23-q24.1. El conjunto de nuestras tres familias muestran un ligamiento significativo con todos estos marcadores. El análisis de recombinantes nos ha permitido establecer un intervalo crítico donde se localiza el gen Darier, delimitado por el marcador centromérico o proximal D12S78 y el marcador telomérico o distal D12S1646.
Palabras clave:
Enfermedad de Darier
Piel
Genética
Análisis de ligamiento
Localización del gen
Darier's disease is a disorder of the skin whose clinical expressivity is widely variable and diverse. It is mainly characterized by keratotic papules, oral mucosal alterations, nail distrophy and palmoplantar keratodermia, though other organs may be also affected. Darier's disease is inherited in an autosomal dominant pattern with a prevalence of about 1 in 50,000. The causative gene of Darier's disease was localized on the long arm of chromosome 12, bands q23-q24.1. We have clinically studied three families from our region. The nail distrophy and the palmoplantar keratodermia have been the most frequent signs found in our study. The cutaneous-mucosal affectation showed, in a large degree, an inter and intrafamilial variation. In addition, we have carried out a genetic linkage analysis with nine microsatellites of chromosome 12q23-q24.1 Our set of families gave significant lod scores with all these markers. Our recombinant analysis allowed us to establish a critical interval for the Darier's disease gene delimited, proximally by marker D12S78 and distally by marker D12S1646.
Keywords:
Darier's disease
Skin
Genetics
Linkage analysis
Gene mapping
Texto completo

Actas Dermosifiliogr., 1998;89:519-529

ESTUDIOS CLÍNICOS Y DE LABORATORIO


Estudio clínico y genético de tres familias afectadas por la enfermedad de Darier*

JUAN REDONDO MATEO

ELADIO VELASCO SAMPEDRO1

SUSANA GOMEZ BARRERO1

FERNANDA RODRIGUEZ-SANZ2

LUIS ERICK CLAVERIA SORIA2

Dermatología, 1Unidad de Genética y 2Sección de Neurología. Hospital General. Segovia.

Correspondencia:

DR. JUAN REDONDO MATEO. Hospital General. Ávila, s/n. 40002 Segovia.

Aceptado el 24 de junio de 1998.

* Este artículo obtuvo el Premio Prof. Joaquín Piñol 1998, de los Laboratorios Isdín.


Resumen.--La enfermedad de Darier es un trastorno cutáneo cuya expresividad clínica es variable y diversa, y está caracterizada por la presencia de pápulas queratósicas, lesiones en mucosas, fundamentalmente en boca, alteraciones ungueales y queratodermia palmoplantar, pudiendo afectarse otros órganos de la economía. Se hereda de una forma autosómica dominante y su prevalencia es aproximadamente de 1/50.000.

El gen causante de la enfermedad de Darier fue localizado en el brazo largo del cromosoma 12, bandas q23-q24.1. Desde un punto de vista clínico, hemos estudiado tres familias de nuestro entorno, encontrando que las alteraciones ungueales y la queratodermia palmoplantar son las más frecuentes. La afectación cutaneo-mucosa variaba ampliamente en intensidad y extensión, de unos pacientes a otros, tanto ínter como intrafamiliarmente. Por otro lado, hemos efectuado un análisis de ligamiento genético con nueve microsatélites del cromosoma 12q23-q24.1. El conjunto de nuestras tres familias muestran un ligamiento significativo con todos estos marcadores.

El análisis de recombinantes nos ha permitido establecer un intervalo crítico donde se localiza el gen Darier, delimitado por el marcador centromérico o proximal D12S78 y el marcador telomérico o distal D12S1646.

Palabras clave: Enfermedad de Darier. Piel. Genética. Análisis de ligamiento. Localización del gen.


INTRODUCCIÓN

En ausencia de un defecto bioquímico conocido o de grandes reestructuraciones cromosómicas visibles citogenéticamente, la localización del gen responsable de una enfermedad hereditaria se debe hacer mediante ligamiento genético (1). En este sentido los marcadores polimórficos del ADN han constituido una auténtica revolución en la genética humana. Estos polimorfismos, a los que también se les denomina marcadores, se detectan mediante técnicas moleculares y segregan de forma mendeliana de generación en generación, permitiendo la construcción de mapas genéticos basados en ellos. Los polimorfismos más utilizados son los microsatélites, repeticiones en tándem de secuencias de 1 a 6 pb en número variable, debido a su abundancia en el genoma humano, su fácil manejo y su alto grado de polimorfismo (2). Gracias a su descubrimiento, ha sido posible la construcción de mapas genéticos de alta resolución del genoma humano, el último de ellos incluyendo 5.264 microsatélites (3). Desde 1992, y utilizando estos mapas, se han podido localizar más de 200 loci responsables de otras tantas enfermedades hereditarias. Puede, pues, afirmarse que ahora es posible la localización de cualquier gen causante de una enfermedad, siempre que se disponga de familias con el suficiente número de miembros afectados.

Una vez establecido un ligamiento significativo entre el gen causante de la enfermedad y varios marcadores de un determinado cromosoma, es posible determinar, dentro de una familia afectada de una enfermedad hereditaria, cuál es el cromosoma que segrega con la enfermedad. La detección de individuos recombinantes mediante este análisis permite además precisar la localización del gen causante, etapa previa necesaria para abordar la identificación de dicho gen.

Los progresos en genética humana no se detienen en la localización de genes. Gracias a la tecnología del ADN recombinante, los genes humanos pueden clonarse y caracterizarse a nivel molecular. A este propósito, la construcción de genotecas de YACs (Yeast Artificial Chromosomes), que portan fragmentos de ADN de varios cientos de kb (4), y su posterior ordenamiento en forma de mapas de «contiguos» ha permitido la elaboración de un mapa integrado físico/genético (5). Esto significa que, localizado un gen sobre el mapa genético en un intervalo definido por dos marcadores, la clonación del gen puede realizarse a partir del YAC o YACs que contienen dicho intervalo. Una vez se haya identificado el gen causante, será posible estudiar las mutaciones en el mismo, para así llegar a comprender los mecanismos fisiopatológicos de la enfermedad, y en último término desarrollar una terapia para ella.

La enfermedad de Darier-White es una alteración hereditaria de la piel que presenta un patrón de herencia autosómico dominante, aunque aproximadamente un tercio de los casos no tienen antecedentes familiares (6). La prevalencia varía entre 1/36.000 y 1/100.000 (6, 7).

Esta enfermedad muestra una expresividad variable (6), y se caracteriza principalmente por la presencia de pápulas, de color de la piel o eritematosas, que se cubren de escamocostras, ásperas, de color amarillento o marrón, distribuidas en las zonas seborreicas. Otras manifestaciones de la enfermedad son lesiones como verrugas en el dorso de las manos, alteraciones ungueales, y queratodermia palmoplantar, con pits evidentes. La manifestación extracutánea más llamativa, es la aparición de quistes óseos tanto a nivel mandibular como en otros huesos (8). La enfermedad de Darier, según se ha documentado, también puede estar asociada a obstrucción de las glándulas salivales, agenesia renal y testicular, y a trastornos neuropsiquiátricos (9).

Los estudios histopatológicos y ultraestructurales revelan una ruptura de los complejos filamentosos desmosomaqueratina entre queratinocitos, acantólisis suprabasal con formación de hendiduras y disqueratosis (10, 11). Por lo tanto, aquellos genes que codifiquen para proteínas de citoesqueleto y desmosómicas son, en principio, buenos candidatos a ser responsables de esta enfermedad. El gen Darier se localizó en el brazo largo del cromosoma 12, bandas q23-q24.1 (12, 13), una región donde no se han descrito genes que reúnan estas características. Por otro lado, varios genes, localizados en 12q11, que codifican para distintas isoformas de queratina, han sido descartados como responsables de esta enfermedad mediante análisis de ligamiento (12, 14).

En este trabajo se presenta el primer estudio integrado clínico y genético de familias españolas afectadas de la enfermedad de Darier. Hemos realizado un análisis de ligamiento exhaustivo con nueve marcadores microsatélites que se sitúan en un intervalo de 20 cM dentro del brazo largo del cromosoma 12. Todos ellos presentan un ligamiento significativo con la enfermedad de Darier. El análisis de recombinantes nos ha permitido establecer un intervalo crítico donde se localiza el gen Darier, delimitado por el marcador centromérico o proximal D12S78 y el marcador telomérico o distal D12S1646. Por último, hemos detectado tres recombinantes en el límite distal de este intervalo que van a facilitar su reducción y, por lo tanto, serán muy importantes para abordar la identificación del gen responsable de la enfermedad de Darier.

PACIENTES, MATERIAL Y MÉTODOS

Pacientes

Hemos estudiado tres familias, sin relación entre ellas, afectadas de la enfermedad de Darier (Fig. 1); compuestas por 77 miembros, de los que han sido analizado un total de 60 miembros, 25 de los cuales (13 varones y 12 hembras) eran afectados. Uno de los varones, individuo uno de la generación I del pedigrí DAR-02 (Fig. 1) pudo incluirse en el estudio, dado que su historial clínico e histopatológico se conocía con anterioridad.

FIG. 1.--Árboles genealógicos de las tres familias afectadas por la enfermedad de Darier. Los individuos afectados están representados por símbolos rellenos de negro, los no afectados como símbolos vacíos, los individuos fallecidos se han cruzado con una línea diagonal. Los individuos que se suicidaron están marcados con un aspa.

La valoración dermatológica ha consistido en la anamnesis, teniendo en cuenta la exposición a factores agravantes y condicionantes, procesos infecciosos presentados, tanto generales como cutáneos, y en la exploración cutaneomucosa de todos los sujetos incluidos en el estudio. El diagnóstico se confirmó mediante biopsia cutánea en al menos un paciente de cada familia (un total de siete casos).

Purificación de ADN genómico. Genotipado

de marcadores microsatélites

El ADN de cada individuo se purificó mediante el método salino a partir de 10 ml de sangre periférica depositados en tubos EDTA (15). En un caso (individuo I-1 del pedigrí DAR-02), el ADN se obtuvo a partir de biopsia de piel incluida en parafina (16).

Estudiamos los siguientes microsatélites: D12S78, D12S353, D12S84, D12S1583, D12S1645, D12S1344, D12S1646, D12S354 y D12S86 (3). Con el fin de evitar el uso de radiactividad y simplificar el tipado de todos estos microsatélites, hemos desarrollado un protocolo novedoso basado en PCR no radiactivo. Para ello, se diseñaron nuevos oligonucleótidos y nuevas condiciones de PCR (tabla I).

TABLA I: NUEVOS OLIGONUCLEOTIDOS Y CONDICIONES DE PCR PARA LA AMPLIFICACION DE LOS MICROSATÉLITES

Marcadores micro-

satélites

Oligonucleótidos PCR

[MgC12] (mM)Tamaño del ampli-

ficado (pb)
Tempera-

tura de unión

D12S78 5''CTTTGCAGCACCATGTATTT3''1,019161 °C
5''TTGAACTGCTGGCTTTAACA3''
D12S353 5''CAGAATTCATTGGGAGGGC3''1,010365 °C
5''GACTGTGGCAAATCGGAGAG3''
D12S84 5''GCTTACAGTAGGTGCTTAATAAAT3''1,012558 °C
5''TTCCCCCAGATAAGAACTCT3''
D12S1583 5''GAAAGTAAAAATGCATTTCA3''1,016156 °C
5''CTTGTTTACTTCCAGTAGCTT3''
D12S1645 5''CACATACCTGGCTGTTACAG3''1,011354 °C
5''GCAAGTCATATCATGGAGAA3''
D12S1344 5''GTGAGGTAATCTATGGCTTGA3''1,017559 °C
5''GCAGACGAAATCATCAGAAG3''
D12S1646 5''GGTTATAAAATGAAATGATGC3''1,011958 °C
5''TAGTGTTTATTGAGCAATGTG3''
D12S354 5''GCCCATTGCATTATCTTTT3''1,013558 °C
5''TCTCAGGAAAGGGAACCAAT3''
D12S86Dib y cols. (3)0,612454 °C

Las reacciones de PCR se llevaron a cabo en un volumen final de 20 µl que contenían: 50 ng de ADN genómico, 12 pmol de cada oligonucleótido, 200 µM de cada dNTP, tampón estándar de PCR, MgC12 a las concentraciones indicadas en la tabla I, y 1 U de la polimerasa de Thermus aquaticus. Las condiciones de amplificación fueron las siguientes: una etapa de desnaturalización a 94 °C durante tres minutos, seguida de 30 ciclos consistentes en una desnaturalización a 94 °C durante 30 segundos y unión de los oligonucleótidos a la temperatura indicada en la tabla I, durante 45 segundos. Por último, se realizó una etapa de elongación final a 72 °C durante tres minutos.

Los alelos de cada marcador se visualizaron en geles nativos de poliacrilamida al 6-7% tras tinción con bromuro de etidio (17).

Análisis de ligamiento

Una medida de la significación estadística del ligamiento entre un marcador y la enfermedad viene dada por el lod score. El cálculo de lod score se efectúa a diferentes fracciones de recombinación (entre la enfermedad y un marcador dado), siendo el lod score máximo (Zmax.) el que estima la fracción de recombinación (*) o distancia genética más probable entre la enfermedad y dicho marcador. Un lod score máximo igual o mayor de 3,0 indica que el marcador y el gen de la enfermedad están ligados (1) y, por lo tanto, conociendo la posición del marcador se infiere que el gen causante se sitúa cercano sobre el mismo cromosoma.

El cálculo de lod score puede realizarse mediante diferentes paquetes informáticos. En nuestro caso, se llevó a cabo mediante los programas lod score y mlink del paquete informático linkage v5.1 (18). Al ser la enfermedad de Darier una enfermedad de penetrancia dependiente de edad, se hicieron las correcciones oportunas para el cálculo del lod score (9, 13).

RESULTADOS

Clínica de los pacientes

En el momento de la exploración, las edades de los 25 pacientes con enfermedad de Darier oscilaban entre los 12 y 71 años, con edades de comienzo entre los 9 y 20 años.

La afectación cutánea se ha presentado, en 16 casos, en forma de pápulas escamosas y lesiones pigmentarias en cuero cabelludo y cara, siendo llamativa la afectación en frente (Fig. 2). Por otro lado, en 23 pacientes se ha observado la presencia de pápulas eritematosas en el tronco, mayoritariamente de disposición folicular, marrones, queratósicas, en intensidad y extensión variables. Así, mientras que en cinco de estos pacientes se presentaban en el plano anterior y dorso de tórax, de forma difusa, o en forma menos extensa (Fig. 3), el resto de los pacientes mostraban pocas lesiones con predominio en las zonas seborreicas. La localización de lesiones a nivel de pliegues retroauriculares, axilares e inguinales, era poco llamativa.

FIG. 2.--Frente y cuero cabelludo con pápulas queratósicas y lesiones pigmentarias (paciente DAR-01, III-3).

FIG. 3.--Pápulas eritematosas en plano anterior de tórax (paciente DAR-03, II-3).

En cinco pacientes, hemos observado pápulas en extremidades superiores e inferiores, en todo su contorno. La histopatología de una biopsia de lesiones papulosas ha mostrado la existencia de hendiduras suprabasales, acantólisis y presencia de granos y cuerpos redondos (Fig. 4).

FIG. 4.--Acantólisis, hendiduras suprabasales, disqueratosis, granos y cuerpos redondos en pápula de tórax (paciente DAR-01, III-8) HE x 40.

La queratodermia palmar se ha observado en 21 casos; no era difusa, respetando partes de eminencias tenares, hipotenares y huecos palmares, y era menos intensa en la cara palmar de las falanges de los dedos, con pits muy característicos en 12 pacientes (Fig. 5). En el estudio histopatológico de una biopsia de queratodermia plantar se apreciaban hendiduras y fisuras suprabasales. En 15 pacientes aparecía una queratodermia plantar de las mismas características que respetaba parte de los huecos plantares y los bordes peroneal y tibial.

FIG. 5.--Queratodermia palmar con pits (paciente DAR-01, IV-9).

En cuanto a la afectación bucal, sólo se ha observado a nivel de la mucosa de paladar, sin una intensidad acentuada, salvo en el caso de una paciente con afectación cutánea generalizada, en la que todo el paladar estaba tachonado de lesiones papulosas, que le daban un aspecto «guijarroso». En una paciente se apreciaron alteraciones dentarias, consistentes en separación dental, presencia de muescas en el borde libre de los incisivos, y caninos cónicos (Fig. 6); las mismas alteraciones mostraba su hijo, clasificado como presintomático, como veremos más adelante.

FIG. 6.--Alteraciones dentarias (paciente DAR-01, IV-17).

La alteración ungueal se ha observado en 18 pacientes, principalmente en las uñas de las manos, en unos casos con afectación de algunos dedos, y en otros, de todas las uñas, con bandas longitudinales, blancas o eritematosas. En 11 de ellos se detectó la presencia de muescas en su borde distal con onicólisis, mientras que en cinco casos se advirtió una afectación en forma de «V», bien coincidente con las muescas (cuatro casos), bien como única manifestación ungueal. En varios pacientes la afectación ungueal condicionó la rotura de la lámina ungueal de todas las uñas, que se apreciaban blandas y delgadas. Una paciente, además de estas alteraciones, mostraba hematomas subungueales frecuentes y persistentes (Fig. 7), así como lesiones papulosas semejantes a verrugas planas en el dorso de los dedos y carpo, que también apreciamos en otros seis pacientes (Fig. 8).

FIG. 7.--Hematomas subungueales, bandas y estrías longitudinales (paciente DAR-01, III-8).

FIG. 8.--Pápulas semejantes a verrugas, bandas longitudinales blanquecinas y muesca en borde libre ungueal (paciente DAR-01, III-11).

En cuanto a los factores agravantes, 14 pacientes empeoraban en verano, y cinco de éstos también con el sudor. Otros tres no notaron empeoramiento en el verano, aunque sí con la sudoración. Dos pacientes manifestaron mal olor de las lesiones en épocas de verano y con la sudoración, otros dos apreciaron acentuación de las lesiones con el estrés y una sensación de prurito con las prendas de lana.

En cuanto a las patologías asociadas a la enfermedad de Darier, se valoraron, en primer lugar, los trastornos neurológicos y psiquiátricos. Una paciente, cuya afectación cutaneomucosa era muy extensa y llamativa, mostraba una esclerosis múltiple; otro paciente, epilepsia, y otros dos, un proceso depresivo; uno de ellos se suicidó poco antes del presente estudio. Otras patologías observadas han sido la presencia de quistes óseos en las extremidades superiores de una paciente y quistes maxilares en otra, ambas de la misma familia, así como la aparición de quistes de riñón e ictiosis en otra paciente. Los pacientes manifestaron no haber padecido procesos cutáneos víricos, como herpes simple, zoster o verrugas de repetición, ni procesos infecciosos de otra naturaleza.

Únicamente ocho pacientes han seguido un tratamiento; dos de ellos, tratados con derivados del ácido retinoico por vía oral (etretinato e isotretinoína), manifestaron mejoría durante su realización y seis, con tratamiento tópico, presentaron una respuesta pobre y variable. El resto de los pacientes no ha seguido ningún tratamiento, aunque aquellos que llevaban más años con el proceso indicaron cierta disminución de su clínica cutánea con el paso del tiempo.

Por último, cabe señalar que hemos observado, sin haber efectuado ningún estudio psicológico, que los pacientes presentaban un perfil típico, principalmente caracterizado por su docilidad. De igual modo, varios pacientes con importante afectación cutánea y de procedencia urbana manifestaron un cierto grado de retraimiento y dificultad en las relaciones sociales, en contraposición a los pacientes que viven en medio rural, que no lo consideraron relevante.

Análisis de ligamiento genético

Con el fin de realizar un análisis de ligamiento en nuestras tres familias (Fig. 1), se tiparon un total de 60 miembros con los nueve marcadores microsatélites, detallados en materiales y métodos, de la región cromosómica 12q23-q24.1, donde previamente se había localizado el gen Darier (12, 13). Los datos del tipado se procesaron con los programas lod score y Mlink. Los resultados se presentan en la tabla II, donde se muestran los valores de lod score obtenidos a diferentes frecuencias de recombinación para los nueve marcadores microsatélites estudiados. El lod score máximo (Zmáx.) estima la frecuencia de recombinación (* máx.) o distancia genética más probable entre el marcador y la enfermedad. Así, por ejemplo, la Zmáx. obtenida para el marcador D12S1583 es de 4,64 a una frecuencia de recombinación de 0,00, lo que indica que este marcador está estrechamente ligado al gen Darier. Los Zmáx. calculados para todos los marcadores resultaron significativos (valores superiores a 3,0), lo cual indica que nuestras familias también están ligadas al gen Darier en el cromosoma 12q23-q24.1.

TABLA II:LORD SCORE A DOS PUNTOS ENTRE LA ENFERMEDAD Y NUEVE MARCADORES MICROSATÉLITES DEL BRAZO LARGO DEL CROMOSOMA 12

Frecuencias de recombinación (*)

DAR vs0,000,010,050,10,20,30,4 Zmáx.**máx.*
D12S78­0,333,394,003,963,242,080,674,040,068
D12S3537,367,236,695,994,492,871,147,360,000
D12S848,478,337,746,975,333,521,558,470,000
D12S15834,644,554,223,792,891,910,874,640,000
D12S164511,0310,8510,119,147,064,772,2311,030,000
D12S13446,386,265,805,213,952,621,216,380,000
D12S1646­6,112,273,413,583,132,251,083,580,094
D12S3544,274,213,973,622,811,880,864,270,000
D12S86­4,512,734,294,473,752,461,004,480,088

*Zmáx. es el lod score máximo a la frecuencia de recombinación *máx.*

Análisis de haplotipos recombinantes

Un haplotipo representa el orden de los alelos de los diferentes marcadores a lo largo de un cromosoma. Este haplotipo se construye en base a la segregación, dentro de una familia, de los alelos de los marcadores estudiados. La ruptura de este orden, por un fenómeno de recombinación o intercambio de material genético entre dos cromosomas parentales, da lugar a un haplotipo recombinante, cuyo estudio es esencial para precisar la localización de un gen causante de enfermedad.

La Figura 10 muestra nuestro análisis de haplotipos recombinantes (señalados con una flecha), que son clave para establecer la posición del gen Darier.

El individuo 2 de la generación IV del pedigrí DAR-01 (Fig. 9 a) muestra una recombinación con el marcador D12S78 en el cromosoma materno. En efecto, este individuo sano ha recibido el cromosoma materno afectado a nivel del marcador D12S78; sin embargo, ha recibido el cromosoma sano materno para el resto de los marcadores. Esto indica que el gen causante de Darier está localizado en una posición distal (telomérica) a D12S78. Del mismo modo, la recombinación que porta el individuo 7 de la generación II del pedigrí DAR-02 (Fig. 9 b) posiciona la enfermedad distal a D12S78 (ver el orden de los marcadores en el mapa genético de la Fig. 10).

B

FIG. 9.--Análisis de haplotipos de las familias. A) DAR-01 y B) DAR-02. En la figura se muestra una representación parcial de los árboles genealógicos de ambas familias. Los marcadores utilizados se indican a la izquierda y en un orden, de arriba a abajo, de centrómetro a telómero. Los números representan los alelos recodificados para cada marcador microsatélite. Las barras negras representan el cromosoma afectado, mientras que las blancas simbolizan a los cromosomas sanos. Las barras mixtas blancas/negras representan a los cromosomas recombinantes. Mediante flechas se destacan los individuos recombinantes. Entre corchetes se señala al individuo presintomático.

FIG. 10.--Mapa genético de la región del cromosoma 12 que contiene el gen Darier. cen: centrómetro; qter: telómero del brazo largo.

Por otro lado, el individuo afectado número 5 de la generación III de la familia DAR-01 (Fig. 9 a) presenta una recombinación en el cromosoma afectado materno con el marcador D12S86, es decir, porta un cromosoma afectado para todos los marcadores excepto para D12S86. Este resultado indica que el gen Darier está localizado proximal (centromérico) a D12S86. Esta misma conclusión se extrae del análisis del individuo sano número 1 de la generación IV de esta misma familia.

Por último, aplicando este mismo tipo de análisis a los individuos 7, 14 (ambos afectados) y 22 (sano) de la generación IV del pedigrí DAR-01 (Fig. 9 a), detectamos, en cada uno de ellos, una recombinación entre la enfermedad y el marcador D12S1646, de modo que posiciona al gen Darier proximal (centromérico) a D12S1646 (ver Fig. 10). Estos tres recombinantes son muy importantes, dado que dicho marcador es el límite distal más cercano al gen hasta ahora descrito (19).

Todos estos resultados indican que el gen Darier se localiza en un intervalo genético delimitado proximalmente por el marcador D12S78 y distalmente por el marcador D12S1646 (ver Fig. 10).

Cabe destacar el caso del niño número 3 de la generación V de la familia DAR-01, que en la Figura 10 se destaca entre corchetes. Este niño presenta una recombinación a nivel del marcador D12S354, portando el cromosoma afectado materno para todos los marcadores menos para D12S354 y D12S86. Como el gen Darier se localiza entre D12S78 y D12S1646, según indican nuestros resultados (ver Fig. 10), este niño porta el gen Darier mutado, y por lo tanto debería presentar la enfermedad, de modo que fue clasificado como presintomático. De hecho, en el transcurso de este estudio este individuo no mostró ningún signo típico de la enfermedad, salvo la presencia de lesiones como verrugas planas en el dorso de las manos. Sin embargo, en una reciente exploración clínica se pudo observar que el niño presentaba lesiones queratósicas palmares como las de su madre aunque de menor intensidad.

DISCUSIÓN

En este trabajo se presenta el primer estudio conjunto clínico-genético de familias españolas afectadas de la enfermedad de Darier. Burge y Wilkinson (9), en la serie más grande estudiada de 163 casos de enfermedad de Darier, distinguen, en base a la distribución de las lesiones, cuatro modelos clínicos: seborreico, flexural, nevoide y acral. Sin embargo, en nuestros casos no hemos observado las variedades flexural y nevoide referidas en otras series (20), ni tampoco la variedad hipertrófica de lesiones vegetantes y verrugosas (21). En cambio, hemos encontrado que la variedad acral, palmar y plantar, ha sido mayoritaria (21 casos). Dicha variedad, junto a las alteraciones ungueales, pueden ser, en ocasiones, una manifestación precoz de la enfermedad, y son las menos sensibles a la remisión espontánea o con tratamiento (6).

Nos ha llamado la atención la presencia de lesiones pigmentarias evidentes en frente (Fig. 2), alternando con las lesiones papulosas, coincidentes con las observadas en otro trabajo (22). Las alteraciones dentarias de una paciente (Fig. 7) y su hijo de tres años no habían sido descritas hasta ahora en la enfermedad de Darier, si bien es verdad que nuestra serie no es lo suficientemente grande como para asegurar que dichas alteraciones estén asociadas a la enfermedad de Darier.

Asimismo cabe destacar de esta queratodermia, a nivel histopatológico, la presencia de hendiduras suprabasales, acantólisis y disqueratosis poco acentuada, junto con hiperqueratosis ortoqueratósica, exoserosis, hipergranulosis y acantosis, de acuerdo con lo referido por otros autores (23).

En cuanto a la afectación ungueal, hay que hacer notar su variable expresividad, y la presencia de hematomas subungueales en una paciente, como una manifestación adicional de este tipo de lesiones equimóticas, ya descritas anteriormente (24).

La luz solar constituye uno de los factores exarcebantes de las lesiones (9), hecho comprobado mediante la inducción por rayos ultravioleta (25, 26). Nuestros datos confirman esta observación ya que un 56% de nuestros pacientes refirieron un patente empeoramiento estival.

Nuestros pacientes no han presentado procesos infecciosos cutáneos o generales, corroborando la inconsistencia y variabilidad de las alteraciones inmunológicas estudiadas en algunos pacientes de Darier y que, por lo tanto, no necesariamente indican la existencia de un trastorno inmunológico general subyacente (27).

En relación a las patologías asociadas de este proceso, señalar que hay una importante prevalencia de trastornos neurológicos y psiquiátricos en nuestros pacientes (15,3%) ya referido por otros autores (9, 20). Además, se ha observado cierta tendencia al suicidio en la enfermedad de Darier (28, 29), como fue el caso de uno de nuestros pacientes. La actitud de retraimiento social y emocional ha sido evidente en los pacientes con gran afectación, más jóvenes y en los de edad media, y de procedencia urbana, concluyendo que este proceso no condiciona negativamente en la mayoría de los pacientes su vida familiar y laboral (30). Por último, si bien la asociación a patología ósea es un tema controvertido (9, 31), dos de nuestras pacientes, cuya expresividad cutánea era muy intensa, presentaron quistes óseos, por lo que es posible que la aparición de esta patología sea dependiente de la intensidad de la afectación cutánea.

En cuanto al estudio genético, hemos analizado estas familias con nueve marcadores microsatélites, que se localizan en el brazo largo del cromosoma 12. Queremos destacar en primer lugar, la puesta a punto de un protocolo que simplifica notoriamente el tipado de estos microsatélites, y evita el uso de nucleótidos radiactivos en la reacción de PCR.

Nuestro análisis de ligamiento demuestra que el origen de la enfermedad en estas familias está en una mutación en el gen Darier, que previamente se había localizado en el cromosoma 12q23-q24.1 (12, 13). Prueba de ello es el ligamiento significativo que muestran todos estos marcadores con el locus de la enfermedad (valores de lod score superior a 3,0). Este resultado además apoya la hipótesis de homogeneidad genética, es decir, la enfermedad de Darier está causada por mutaciones en un único gen, situado en el cromosoma 12q23-q24.1. De hecho, hasta el momento no se ha descrito, a nivel mundial, ninguna familia que no presente ligamiento a marcadores de esta región cromosómica.

Por otro lado, nuestros datos demuestran que la variabilidad clínica intrafamiliar observada no es debida a diferentes mutaciones en el gen Darier, puesto que todos los pacientes de una misma familia portan el mismo cromosoma afectado. De aquí se deduce que si bien hay un único gen cuya mutación causa la enfermedad de Darier, debe haber otros factores genéticos y ambientales implicados en la modulación de la expresión de la enfermedad.

Aproximadamente, un tercio de los casos descritos de la enfermedad de Darier, son esporádicos (6). La hipótesis más aceptada para explicar este alto porcentaje de casos esporádicos, es la aparición de mutaciones espontáneas o de novo en el gen Darier. Si así fuera, ello implicaría que los casos esporádicos transmitirían la enfermedad a su descendencia mediante un patrón de herencia autosómico dominante. En nuestro estudio, los individuos número 1 de la generación I de los pedigrís DAR-02 y DAR-3 no tenían antecedentes familiares de la enfermedad, por lo que pueden ser considerados como casos esporádicos. Más aún, estos dos pacientes han transmitido la enfermedad a su descendencia (ver Fig. 1), confirmando la hipótesis previamente mencionada.

Una de las aportaciones más interesantes de nuestro estudio genético es la identificación de individuos presintomáticos. En efecto, en un principio habíamos detectado que el individuo 3 de la generación V de la familia DAR-01 de tres años de edad, portaba el cromosoma afectado materno aunque durante el estudio no había mostrado ningún síntoma de la enfermedad de Darier, salvo verrugas planas en el dorso de las manos y caninos cónicos. De hecho, no es de extrañar, ya que sólo un 25% de los pacientes menores de 10 años desarrolla la enfermedad (9). Sin embargo, en una exploración reciente ya se le han detectado unos leves síntomas de la enfermedad, como se ha comentado en el apartado de resultados, confirmando así nuestros hallazgos genéticos. Por tanto, la presencia en un niño de numerosas lesiones semejantes a «verrugas planas», así como las alteraciones ungueales propias de la enfermedad de Darier, deben hacer sospechar que éste pueda desarrollar posteriormente las lesiones papulosas características de la enfermedad (32). Por el contrario, hemos determinado que los individuos 1 y 2 de la generación V de DAR-01 no van a desarrollar la enfermedad puesto que ambos han heredado el cromosoma materno sano (resultados no mostrados). Por tanto, los estudios de ligamiento con marcadores polimórficos pueden ser beneficiosos para jóvenes asintomáticos o levemente afectados de familias Darier, debido a su capacidad de detectar el cromosoma que aporta la enfermedad.

Mediante el análisis de haplotipos recombinantes, hemos determinado que el gen Darier se localiza dentro de un intervalo delimitado por los marcadores D12S78 y D12S1646, lo cual está de acuerdo con lo documentado por otros autores (19, 33, 34). Dado que el marcador D12S1646 constituye el límite distal más cercano al gen Darier descrito hasta la fecha, nuestros tres recombinantes con dicho marcador adquieren especial relevancia de cara a la reducción del intervalo crítico y, por consiguiente, para la identificación del gen Darier.

Al no haber genes candidatos descritos en esta región, la genética posicional se mantiene como el abordaje principal para la caracterización definitiva del gen responsable. Recientemente, se ha publicado un mapa físico de esta región cromosómica (35). Sin embargo, este mapa está incompleto, por lo que, antes de emprender la caracterización del gen, es fundamental centrar el trabajo en su refinamiento mediante, por ejemplo, la construcción de un «contiguo» de YACs que abarque toda esta región. Además en esta región hay una gran escasez de marcadores polimórficos, por lo que el aislamiento de nuevos microsatélites proximales a D12S1646, y su tipado en nuestros tres recombinantes permitirá el acotamiento de la región candidata que contiene el gen Darier. En este sentido, es necesaria una estrecha colaboración entre dermatólogos y genetistas, inquietud recogida recientemente por otro autor (36), para recolectar más familias afectadas de Darier, con el mayor número posibles de enfermos, estudiarlas genéticamente, y así poder cumplir estos objetivos.

Una vez reducido el intervalo, queda la tarea más complicada que es la identificación del gen causante. Serán buenos genes candidatos aquellos que presenten similitud con proteínas de citoesqueleto, que se expresen tanto en piel como en cerebro, ya que en la enfermedad de Darier hay una alta prevalencia de trastornos psiquiátricos y/o neurológicos. La identificación de mutaciones en pacientes de Darier, y su ausencia en la población normal, será la clave para la identificación del gen. Además permitirá la resolución de enigmas tales como los casos de enfermedad de Darier localizada, sin antecedentes familiares, que no ha sido reconocida como tal por algunos autores (8) pudiendo ser debidos a un mosaicismo somático por una mutación postcigótica en el gen Darier (37, 38).

El avance en la genética molecular de la enfermedad de Darier traerá consigo la comprensión de los mecanismos bioquímicos y fisiopatológicos que subyacen a la enfermedad, y contribuirán, en un futuro próximo, al desarrollo de terapias para combatirla.

AGRADECIMIENTOS

En primer lugar queremos agradecer la colaboración de las familias afectadas de la enfermedad de Darier que participaron en este estudio, y al Dr. Luis Arranz Arra, del Centro de Salud de Roa de Duero (Burgos), que hizo posible la extracción de muestras de sangre de los miembros de la familia DAR-01. También queremos mostrar nuestro reconocimiento a la Unidad de Genética Molecular del Hospital «Ramón y Cajal» que con su apoyo técnico ha permitido que este trabajo fructificara.

Abstract.--Darier''s disease is a disorder of the skin whose clinical expressivity is widely variable and diverse. It is mainly characterized by keratotic papules, oral mucosal alterations, nail distrophy and palmoplantar keratodermia, though other organs may be also affected. Darier''s disease is inherited in an autosomal dominant pattern with a prevalence of about 1 in 50,000. The causative gene of Darier''s disease was localized on the long arm of chromosome 12, bands q23-q24.1.

We have clinically studied three families from our region. The nail distrophy and the palmoplantar keratodermia have been the most frequent signs found in our study.

The cutaneous-mucosal affectation showed, in a large degree, an inter and intrafamilial variation. In addition, we have carried out a genetic linkage analysis with nine microsatellites of chromosome 12q23-q24.1 Our set of families gave significant lod scores with all these markers.

Our recombinant analysis allowed us to establish a critical interval for the Darier''s disease gene delimited, proximally by marker D12S78 and distally by marker D12S1646.

Redondo Mateo J, Velasco Sampedro E, Gómez Barrero S, Rodríguez-Sanz F, Erick Clavería L. A Clinical and genetic study of three Darier''s disease affected families. Actas Dermosfiliograf 1998;89: 519-529.

Key words: Darier''s disease. Skin. Genetics. Linkage analysis. Gene mapping.


BIBLIOGRAFÍA

1. Ott J. Analysis of human genetic linkage. Baltimore: Johns Hopkins. University Press, 1991.

2. Beckmann J, Weber JL. Survey of human and rat microsatellites. Genomics 1992;12:627-31.

3. Dib C, Fauré S, Fizames C y cols. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 1996;380:152-4.

4. Albertsen HM, Abderrahim H, Cann HM, Dausset J, Le Paslier D, Cohen D. Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc Natl Acad Sci USA 1990;87:4256-60.

5. Cohen D, Chumakov I, Weissenbach J. A first-generation physical map of the human genome. Nature 1993;366:698-701.

6. Munro CS. The phenotype of Darier''s disease: penetrance and expressivity in adults and children. Br J Dermatol 1992;127:126-30.

7. Svendsen IB, Albrechtsen B. The prevalence of dyskeratosis follicularis (Darier''s disease) in Denmark. An investigation of the heredity in 22 families. Acta Derm Venereol 1959;39:256-69.

8. Philips SB, Baden HP. Darier-White disease (keratosis follicularis) and miscellaneous hyperkeratotic disorders. En: Fitzpatrick TB, Eisen AZ, Wolff K, Freedberg IM, Austen KF, eds. Dermatology in general Medicine 4.ª ed., vol. I. New York: McGraw-Hill Inc, 1993: p. 547-52.

9. Burge S, Wilkinson DJ. Darier-White disease: a review of the clinical features in 163 patients. J Am Acad Dermatol 1992;27:40-50.

10. Caulfield JB, Wilgram GF. An electron-microscopic study of dyskeratosis and acantholysis in Darier''s disease. J Invest Dermatol 1963;41:57-65.

11. Gottlieb SK, Lutzner MA. Darier''s disease: an electron microscopic study. Arch Dermatol 1973;107:225-30.

12. Bashir R, Munro CS, Mason S, Stephenson A, Rees JL, Strachan T. Localisation of a gene for Darier''s disease. Hum Mol Genet 1993;2:1937-9.

13. Craddock N, Dawson E, Burge S y cols. The gene for Darier''s disease maps to chromosome 12q23-q24.1. Hum Mol Genet 1993;2:1941-3.

14. Parfitt E, Burge S, Craddock N y cols. The gene for Darier''s disease maps between D12S78 and D12S79. Hum Mol Genet 1994;3:35-8.

15. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

16. Mark A, Trowell H, Dyall-Smith M, Dyall-Smith D. Extraction of DNA from paraffin-embedded pathology specimens and its use in hibridization (histoblot) assays. Application to the detection of human papillomavirus DNA. Nucleic Acids Res 1987;15:8565.

17. Velasco E, Valero C, García E y cols. Isolation of microsatellites from the spinal muscular atrophy (SMA) candidate region on chromosome 5q and linkage analysis in Spanish SMA families. Eur J Hum Genet 1995;3:96-101.

18. Lathrop GM, Lalouel JM. Easy calculation of lod scores and genetic risks on small computers. Am J Hum Genet 1984;36:460-5.

19. Bryce S, Carter S, Twells R y cols. Genetic and physical mapping of the Darier''s disease region on chromosome 12q23-q24.1. Single Chromosome Workshop 12, GDB Edit Group, 1995.

20. Beck A, Finocchio A, White J. Darier''s disease: a kindred with a large number of cases. Br J Dermatol 1977;97:355-9.

21. Moreno-Giménez JC, Mozo-Vargas P, Rodríguez-Pichardo A, Camacho-Martínez F. Enfermedad de Darier (variedad hipertrófica). Actas Dermosifiliogr 1982;73:239-44.

22. Kellum RE, Haserick JR. Localized linear keratosis follicularis. Arch Dermatol 1962;86:450-4.

23. Jones WN, Nix TE, Clark WH. Hemorrhagic Darier''s disease. Arch Dermatol 1964;89:523-7.

24. Baran R, Dawber RPR. The nail in dermatological diseases. En: Baran R, Dawber RPR, eds. Diseases of the nails and their management 2.ª ed. London: Blackwell Scientific Publ, 1994; p. 135-74.

25. Plantin P, Le Noac''h E, Leroy J, Gourcuff H. Maladie de Darier, localisée, récidivante et photo-induite suivant les lignes de Blaschko. Ann Dermatol Venereol 1994;121:393-5.

26. Otley C, Momtaz K. Induction of Darier-White disease with UVB radiation in a clinically photo-insensitive patient. J Am Acad Dermatol 1996;34:931-4.

27. Halevy S, Weltfriend s, Pick AI y cols. Immunologic studies in Darier''s disease. Int J Dermatol 1988;27:101-5.

28. Denicoff K, Lehman Z, Rubinow D, Schmidt P, Peck G. Suicidal ideation in Darier''s disease. J Am Acad Dermatol 1990;22:196-8.

29. Milton G, Peck G, Fu J-J y cols. Exacerbation of Darier''s disease by lithium carbonate. J Am Acad Dermatol 1990;23:926-8.

30. Harris A, Burge S, Dykes P, Finlay A. Handicap in Darier''s disease and Hailey-Hailey disease. Br J Dermatol 1996; 135:959-63.

31. Thambiah AS, Sridhar U, Annamalai R y cols. Darier''s disease with cystic changes in the bones. Br J Dermatol 1966;78:87-90.

32. Waisman M. Verruciform manifestation of keratosis follicularis. Arch Dermatol 1966;93:305-10.

33. Carter SA, Bryce SD, Munro CS y cols. Linkage analysis in British pedigrees suggest a single locus for Darier disease and narrow the location to the interval between D12S105 and D12S129. Genomics 1994;24:378-82.

34. Wakem P, Ikeda S, Haake A y cols. Localization of the Darier disease gene to a 2-cM portion of 12q23-q24.1. J Invest Dermatol 1996;106:365-7.

35. Kucherlapati R, Marynen P, Turc-Carel C. Report of the fourth international workshop on human chromosome 12 mapping, 1997. Cytogenet Cell Genet 1997;78:81-95.

36. Puig L. Genética y Dermatología. Dermocosm Clin 1997;5:239-50.

37. Munro CS, Cox NH. An acantholytic dyskeratotic epidermal naevus with other features of Darier''s disease on the same side of the body. Br J Dermatol 1992;127:168-71.

38. Cambiaghi S, Brusasco A, Grimalt R, Caputo R. Acantholytic dyskeratotic epidermal nevus as a mosaic form of Darier''s disease. J Am Acad Dermatol 1995;32:284-6.


Abreviaturas: cM: centiMorgan; dNTPs: desoxinucleótidos trifosfato; kb: kilopares de bases; pb: pares de bases; PCR: Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa); YAC: Yeast Artificial Chromosome (Cromosoma Artificial de Levadura); Zmáx.: lod score máximo; *: fracción de recombinación.

Idiomas
Actas Dermo-Sifiliográficas

Suscríbase a la newsletter

Opciones de artículo
Herramientas
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?